<
>
swopdoc logo
Download
a) trade for free
b) buy for 8.13 $
Document category

Protocol
Biology

University, School

Freie Universität Berlin - FU

Grade, Teacher, Year

unbenotet, 2019

Author / Copyright
Text by Traude L. ©
Format: PDF
Size: 0.29 Mb
Without copy protection
Rating [details]

Rating 5.0 of 5.0 (1)
Networking:
0/0|0[0.0]|0/0







More documents
Fachbereichsarb­eit Germanisitk Entstehung und Entwicklung der deutschen Dialekte Die Einflüsse des Dialekts auf den Alltag der Deutschen Inhaltsverzeich­nis 1. Einführung in das Thema „Dialekt“ 4 2. Der Begriff „Dialekt“ im Allgemeinen 4 3. Entstehung und Entwicklung der deutschen Dialekte 6 3.1. Historische Grundzüge 6 3.2. Phonologische Vorgänge des Lautwandels 7 3.2.1. Die Tenuesverschieb­ung­ 7 3.2.2. Die Medienverschieb­ung­ 8 3.3. Isoglossen 8 3.3.1. Benrather Linie 9 3.3.2. Speyerer Linie 10 3.4. Dialekte…
Johann Wolfgang von Goethe Aufgabenstellun­g: 1. Stellen Sie die verschiedenen Strömungen im lyrischen Schaffen Johann Wolfgang Goethes anhand ausgewählter Texte vor dem Hintergrund der jeweiligen Epochen dar und analysieren sie einen der Texte. 2. Vergleichen Sie zwei der Texte hinsichtlich ihres Menschenbildes. Fach: Deutsch eA Lehrer: Schüler: Gliederung 1. Epocheneinflüss­e: · Sturm und Drang · Klassik (Weimarer Klassik) · Aufklärung 2. Vergleich Menschenbild „Prometheus“ und „Das Göttliche“ 3. Fazit 4. Quellen Ergebnisse:…

Protokoll BBP SoSe 19


Alternatives Spleißen


Hye Young

Versuchspartnerin:


24.-25.04.2019

Zusammenfassung

Im Versuch wurden die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prä-mRNA von Reps1, Traf3, Fam36A und Trim65 untersucht. Zur Analyse wurden zwei RNA-Extrakte aus Celf2-transfizierten bzw. aus Leervektor-transfizierten Zellen verwendet. Zunächst wurde die gewünschte mRNA des jeweiligen Gens in den beiden Extrakten mithilfe von entsprechenden Primern mittels der reverse Transkriptase PCR in cDNA umgeschrieben.

Darauffolgend wurde die spleißsensitive PCR mit den entsprechenden Primern zur Amplifizierung der cDNA durchgeführt. Danach erfolgte die Auftrennung der amplifizierten Fragmente durch die Agarose-Gelelektrophorese. Nach den erhaltenen Ergebnissen wirkt Celf2 auf das alternative Spleißen von Traf3 und Fam36A aus und hingegen nicht auf das von Reps1 und Trim65.

Einleitung

Ca. 40-60 % aller menschlichen Gene unterliegen dem alternativen Spleißen, bei dem aus einem bestimmten DNA-Abschnitt und dementsprechend transkribierter prä-mRNA sich verschiedene reife mRNA-Moleküle und somit unterschiedliche Proteine bilden. Auf diese Weise ist eine menschliche Zelle in der Lage, mit rund 33000 Genen viele hunderttausend verschiedene Proteine herzustellen. [1]

Es gibt verschiedene Formen des alternativen Spleißens: Kassettenexons, mutually exclusive Exons, Intron Retention und Variation der Spleißposition. Die häufigste Kategorie sind die Kassettenexons. Es bezieht sich auf Exons, die entweder in der reifen mRNA enthalten oder ausgespleißt sind. Mutually exclusive Exons werden wechselseitig exkludiert, sodass immer eins dieser Exons enthalten ist.

Durch Variation der Spleißposition, und zwar durch die Verwendung verschiedener 5’ oder 3’ Exons, kann die reife mRNA verlängert oder verkürzt werden. Ein Intron kann auch in der reifen mRNA beibehalten werden, das wird als Intron Retention bezeichnet. [1]

Celf2, das sich auf diesen Versuch ‚alternatives Spleißen‘ bezieht, ist ein ubiquitär exprimiertes, RNA-bindendes Protein. Das wird ins Gehirn, Knochenmark, Fettgewebe, Herz, in die Milz, Lymphknoten und in den Eierstock stark exprimiert und sowohl in Zellkern als auch in Cytoplasma nachgewiesen. Dieses Gen reguliert verschidene Vorgänge in Zellen wie z.B. alternatives Spleißen und Translation und trägt zur mRNA-Stabilität bei.

Celf2 enthält zwei N-terminale RNA-Erkennungsmotive (RRM)- und eine C-terminale RRM-Domäne, sowie einen 160‑230 Aminosäuren-langen Abschnitt zwischen der zweiten und dritten RRM-Domäne, bei dem ein oder mehrere alternatives Spleißen aktivierende Moleküle vorkommen. [2] Das Celf2 wird als ein trans-wirkender Faktor, der an ein cis-wirkendes Element auf der DNA binden kann, bezeichnet.

Ein cis-wirkend Element liegt in unmittelbarer Nähe eines Gens und beeinflusst dessen Transkriptionshäufigkeit verstärkend oder abschwächend. [3]

Die in diesem Versuch hinsichtlich des von Celf2 reguliert werden könnenden alternativen Spleißens zu untersuchenden Gene sind:

- Reps1, das ein Signal-Adaptor Protein, das mit anderen Proteinen interagiert und sich an der Signaling, Endozytose usw. beteiligt, kodiert, [4]

[read full text]
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis
This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis

Bei allen Ansätzen wurden keine Banden detektiert. (b) Gelelektrophoreseergebnis der Gruppe 1. Von links an Ansatz von Leervektor, Celf2-Überexpression und -RT und Marker ‚Quick Load Purple 2 Log‘. Bei den Ansätzen 1 und 2 zu sehen sind die Banden ~100 bp und ~240 bp und der Ansatz 3 stellt eine schwache Bande ~240 bp dar.

Die Fragmentlänge der Ansätze konnten bei dem Ergebnis der eigenen Gruppe 3 nicht abgeschätzt werden, weil es keine Banden zu sehen sind. Bei dem Ergebnis der Gruppe 1 wurden die Banden beobachtet: bei den Ansätzen 1 und 2 zwei Banden gegen 100 bp und 240 bp und bei dem Ansatz 3 gegen 240 bp.

Reps1



Abbildung 2: Gelelektrophoreseergebnis der spleißsensitiven PCR-Produkte der Gruppe 11. Die Reps1-mRNA in den RNA-Extrakten aus Celf2-transfizierten Zellen bzw. aus Leervektor-transfizierten Zellen wurden zunächst in cDNA reverse transkribiert und anschließend cDNA mittels der spleißsensitiven PCR amplifiziert. Darauffolgend wurden die amplifizierten DNA-Fragmente mittels der Gelelektrophorese in einem 2 %-igen Agarosegel bei 100‑120 V aufgetrennt.

Von links an Ansatz von Leervektor, Celf2-Überexpression und -RT und Marker ‚Quick Load Purple 2 Log‘. Bei den Ansätzen 1 und 2 zu sehen sind die Banden ~140 bp und ~210 bp und bei dem Ansatz 3 keine Banden.


Bei dem Ergebnis der Gruppe 11 wurden zwei Banden ~140 bp und ~210 bp bei den Ansätzen beobachtet. Bei dem Ansatz 3 sind keine Banden zu sehen.


Traf3

Abbildung 3: Gelelektrophoreseergebnis der spleißsensitiven PCR-Produkte der Gruppe 6. Die Traf3-mRNA in den RNA-Extrakten aus Celf2-transfizierten Zellen bzw. aus Leervektor-transfizierten Zellen wurden zunächst in cDNA reverse transkribiert und anschließend cDNA mittels der spleißsensitiven PCR amplifiziert. Darauffolgend wurden die amplifizierten DNA-Fragmente mittels der Gelelektrophorese in einem 2 %-igen Agarosegel bei 100‑120 V aufgetrennt.

Von links an Ansatz von Leervektor, Celf2-Überexpression und -RT und Marker ‚Quick Load Purple 2 Log‘. Bei dem Ansatz 1 zu sehen sind die Banden ~30 bp und ~220 bp, bei dem Ansatz 2 ~30 bp, ~150 bp, ~220 bp, 310 bp und 490 bp und bei dem Ansatz 3 ~20 bp.


Bei dem Ergebnis der Gruppe 6 wurden die Banden beobachtet: bei dem Ansatz 1 zwei Banden ~30 bp und ~220 bp, bei dem Ansatz 2 fünf Banden ~30 bp, ~150 bp, ~220 bp, 310 bp und 490 bp und bei dem Ansatz 3 eine Bande ~20 bp.





Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis
This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis

Zur Auswertung wurde das Gelbild der Gruppe 1 aufgenommen. In der Abbildung 1(b) entsprechen die unteren Banden (~100 bp) bei den Ansätzen 1 und 2 der ohne Exon 2 alternativ ausgespleißten mRNA. Die untere Bande bei dem Ansatz 1 mit dem Leervektor ist nicht so intensiv wie bei dem Ansatz 2 mit der Celf2-Überexpression, während die obere Bande (-240 bp) bei dem Ansatz 1 intensiver exprimiert.

Es lässt sich daraus schlussfolgern, dass die Celf2-Überexpression das alternative Spleißen der prä-mRNA von Fam36A beeinflusst.

Vergleicht man die anhand des Markers ‚Quick Load Pulple 2 Log‘ abgeschätzten Fragmentlängen mit den im Anhang ausgerechneten Literaturwerten, lässt sich schnell erkennen, dass die abgeschätzten Werte mit den Literaturwerten relativ gut übereinstimmen. Die Abweichungen der Werte sind durch fehlerhafte Einschätzungen der Fragmentlängen zustande gekommen.


Tabelle 4: Vergleich der erhaltenen Werte mit den Literaturwerten für das alternative Spleißen des Gens Fam36A.


vermittelte Werte [bp]

Literaturwerte [bp]


Ansatz 1

Ansatz 2

Nicht-alternativ gespleißte Länge

240 (intensiver als beim Ansatz 2)

240

243

Alternativ gespleißte Länge

100

100 (intensiver als beim Ansatz 1)

128

Reps1

Das Gelbild der Gruppe 11 wurde ausgewertet. In der Abbildung 2 entsprechen die unteren Banden (~140 bp) der ohne Exon 10 alternativ ausgespleißten mRNA bei den Ansätzen 1 und 2. Die jeweiligen Banden bei dem Ansatz 1 bzw. 2 wurden ähnlich intensiv gebildet. Das deutet an, dass die Celf2-Überexpression keinen Einfluss auf das alternative Spleißen des Gens Reps1 hat.

Im Vergleich zu den ausgerechneten Literaturwerten sind die abgeschätzten Fragmentlängen verträglich. Die Abweichungen der Werte wurden durch fehlerhafte Einschätzungen der Fragmentlängen verursacht.


Tabelle 5: Vergleich der erhaltenen Werte mit den Literaturwerten für das alternative Spleißen des Gens Reps1.


vermittelte Werte [bp]

Literaturwerte [bp]


Ansatz 1

Ansatz 2

Nicht-alternativ gespleißte Länge

210

210

234

Alternativ gespleißte Länge

140

140

153

Traf3

In der Abbildung 3 beim Gelbild der Gruppe 6 ist es erkennbar, dass die Celf2-Überexpression auf das alternative Spleißen bei Traf3 auswirkt.

Die untere Bande (~150 bp) beim Ansatz 2 mit Celf2, die der ohne Exon 8 alternativ ausgespleißten mRNA entspricht, ist beim Ansatz 1 mit Leervektor nicht zu sehen. Die bei allen Ansätzen noch weiter detektierten Banden (~30 bp, 310 bp und 490 bp) sind unspezifisch und entstanden aufgrund der Verunreinigungen.

Das Vergleichen der abgeschätzten Fragmentlängen mit den ausgerechneten Literaturwerten zeigt den Erfolg des alternativen Spleißen Vom Gen Traf3. Durch fehlerhafte Einschätzungen der Fragmentlängen sind die Abweichunge.....

Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis
This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis



Literatur

[1] D. L. Black, Mechanisms of alternative pre-messenger RNA splicing, Annu Rev Biochem., 2003, 72, 291-336.

[2] S. Ramalingam, S. Anant, CELF2 (CUGBP, Elav-like family member 2), Atlas Genet Cytogenet Oncol Haematol, 2015, 19(2), 93-96.

[3] Y. WANG, J. LIU, B. HUANG. , Y.-M. XU, J. LI, L.-F. HUANG, J. LIN, J. ZHANG, Q.-H. MIN, W.-M. YANG, X.-Z. WANG, Mechanism of alternative splicing and its regulation (Review), Biomedical Reports, 2015, 3, 152-158.

[4] Genecards

[5] NCBI

[6] R. Szklarczyk, B. F. Wanschers, L. G. Nijtmans, R. J. Rodenburg, J. Zschocke, N. Dikow, M. A. van den Brand, M. G. Hendriks-Franssen, C. Gilissen, J. A. Veltman, M. Nooteboom, W. J. Koopman, P. H. Willems, J. A. Smeitink, M. A. Huynen, L. P. van den Heuvel, A mutation in the FAM36A gene, the human ortholog of COX20, impairs cytochrome c oxidase assembly and is associated with ataxia and muscle hypotonia, Hum.

Mol. Genet., 2013, 22(4), 656–67.

[7] S. Li, L. Wang, B. Fu, M. E. Dorf, Trim65: a cofactor for regulation of the microRNA pathway, RNA Biol., 2014, 11(9), 1113-1121.

.....

Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis
This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis

Fam36A_rev ------------ 0

Fam36A_for ------------ 26

Fam36A ATTCAATATTGTATGGTTCATTAGGATCTGTTGTGGCTGGCTTTGGACATTTTTTGTTCA 540

Fam36A_rev -----GGAGGGTTTATCTTGGTGACTTTGG 25

Fam36A_for ------------ 26

Fam36A CTAGTAGAATTAGAAGATCATGTGATGTTGGAGTAGGAGGGTTTATCTTGGTGACTTTGG 600

Fam36A_rev GATGCTG----------- 32

Fam36A_for ------------ 26

Fam36A GATGCTGGTTTCATTGTAGGTATAATTATGCAAAGCAAAGAATCCAGGAAAGAATTGCCA 660

- Exonslänge:

Exon 1: 428 bp (1-428),

Exon 2: 115 bp (429-543)

und Exon 3: 64 bp (544-607)

- nicht-alternativ gespleißte Länge: 243 bp (365-607)

- Alternativ gespleißte Länge: 243 bp - 115 bp = 128 bp


Reps1

Tabelle 9: Transkriptionsvarianten des Menschen und deren entsprechenden Längen vom Gen Reps1. [8]

Transkriptionsvariante

bp

1

4033

2

3955

3

4036

4

3763

- Reps1_for: CCAGGTGAGGTAGGTTATTCAGGCTCTCC

- Reps1_rev: GCTTGGAGTCATACGAATGGGAACTGG

- Die komplementäre Sequenz vom Reps1_rev:

CCAGTTCCCATTCGTATGACTCCAATC


- Die codierende Sequenz der Variante 1 mit zwanzig Exons

Reps1_for bindet in Exon 9 und Reps1_rev in Exon 11.

-> Exon 10 wird alternativ gespleißt.


- Gensequenz für Reps1:

Die flankierenden Exons 9 und 11 sind grün markiert, die den Primern entsprechenden Sequenzen gelb und das alternative gespleißte Exon 10 blau.


.....

Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis
This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis

Traf3_for bindet in Exon 7 und Traf3_rev in Exon 9.

-> Exon 8 wird alternativ gespleißt.


- Gensequenz für Traf3:

Die flankierenden Exons 7 und 9 sind grün markiert, die den Primern entsprechenden Sequenzen gelb und das alternative gespleißte Exon 8 blau.


Traf3_rev ------------ 0

Traf3_for --------CACGAAGACACCGACTGTCCCTGC---- 24

Traf3 AGGTTCCGATGATCGCGCTGCAGAAACACGAAGACACCGACTGTCCCTGCGTGGTGGTGT 960

Traf3_rev ------------ 0

Traf3_for ------------ 24

Traf3 CCTGCCCTCACAAGTGCAGCGTCCAGACTCTCCTGAGGAGCGAGTTGAGTGCACACTTGT 1020

Traf3_rev ------------ 0

Traf3_for ------------ 24

Traf3 CAGAGTGTGTCAATGCCCCCAGCACCTGTAGTTTTAAGCGCTATGGCTGCGTTTTTCAGG 1080

Traf3_rev ----------GC 2

Traf3_for ------------ 24

Traf3 GGACAAACCAGCAGATCAAGGCCCACGAGGCCAGCTCCGCCGTGCAGCACGTCAACCTGC 1140

Traf3_rev TGAAGGAGTGGAGCAACTCGCTCG------ 26

Traf3_for ------------ 24

Traf3 TGAAGGAGTGGAGCAACTCGCTCGAAAAGAAGGTTTCCTTGTTGCAGAATGAAAGTGTAG 1200


- Exonslänge:

Exon 7: 81 bp (924-1004),

Exon 8: 75 bp (1005-1079)

und Exon 9: 93 bp (1080-1172)

- nicht-alternativ gespleißte Länge: 238 bp (927-1164)

- Alternativ gespleißte Länge: 238 bp - 75 bp = 163 bp


.....

This page(s) are not visible in the preview.
Please click on download.
Download Die Einflüsse des Proteins Celf2 auf das alternative Spleißen der prämRNA von Reps1, Traf3, Fam36A und Trim65
Click on download to get complete and readable text
• This is a free of charge document sharing network
Upload a document and get this one for free
• No registration necessary, gratis

Legal info - Data privacy - Contact - Terms-Authors - Terms-Customers -
Swap+your+documents